What is a peptide mass fingerprint used for?
Abstract: Peptide mass fingerprinting is a high throughput protein identification technique in which an unknown protein is digested with endoprotease to yield the constituent small peptides. The accurate mass of these peptides is determined by MS analysis. This gives the peak list of peptides of the unknown protein.
Which matrix is commonly used in peptide mass fingerprinting?
CHCA
CHCA has been used widely as a MALDI matrix for peptide mass fingerprint due to its high sensitivity (15).
What are protein fingerprints?
Protein fingerprints are groups of conserved motifs which can be used as diagnostic signatures to identify and characterize collections of protein sequences.
How does MALDI-TOF MS work?
In the case of MALDI-TOF, the analyzer separates molecules based on the time it takes each of them to fly through the time-of-flight tube or “drift” region to the detector. It is this travel through the drift region that separates the molecules.
What is a fingerprint in bioinformatics?
A fingerprint is a group of conserved motifs taken from a multiple sequence alignment – together, the motifs form a characteristic signature for the aligned protein family.
How does protein mapping work?
Peptide mapping is usually performed on an isolated protein or a protein mixture. Identifying a protein using peptide mapping requires digesting the protein into peptides prior to MS analysis. Although most peptide mapping experiments use trypsin to produce peptides, other enzymes (e.g., Lys-C, Glu-C, etc.)
How do you identify a peptide sequence?
In the mass spectrometer, the peptides’ masses are determined and through MS/MS we can confirm their sequence. Any peptide sequences detected are then matched against a protein database to confirm which protein they derive from and thus which proteins were originally present in the sample.
What is the difference between DNA fingerprinting and fingerprinting?
Unlike a conventional fingerprint that occurs only on the fingertips and can be altered by surgery, a DNA fingerprint is the same for every cell, tissue, and organ of a person. It cannot be altered by any known treatment.
What part of the human genome is used for DNA fingerprinting?
STRs are 2-5 bp DNA sequences that are repeated several times in succession. For example, “GATAGATAGATAGATAGATAGATAGATAGATA” is an example of repeated GATA sequences, which is one of the main STR markers used for DNA fingerprinting. STRs occur throughout the genome.
What type of test is MALDI-TOF?
Matrix-assisted laser desorption-ionization time of flight mass spectrometry (MALDI-TOF MS) is replacing traditional methods for identifying microorganisms in the clinical laboratory. This relatively simple technique overcomes many of the challenges of identifying bacteria and fungi.